The scallops used in this study were taken from Nan’ao Marine Biology Station of Shantou University, located at Nan’ao island of Shantou, Guangdong, China. No specific permits were required for the described field studies, as the sampling locations were not privately owned or protected in any way. These field studies also did not include endangered or protected species. The animals were processed according to “the Regulations for the Administration of Affairs Concerning Experimental Animals” established by the Guangdong Provincial Department of Science and Technology on the Use and Care of Animals.
In noble scallop, orange color was dominant to brown color. Color segregation occurred when crossing two orange scallops [28,29]. Both orange and brown scallops used in the present study were from a line of F2 generation produced by continuous crossing orange parental scallops (Figure 1A). A total of 20 orange scallops (rich in carotenoids) and 20 brown scallops (lack of carotenoids) at 14-month old were randomly chosen. Average shell size in length, height and width for the orange was 67.28 ± 4.22 mm, 72.92 ± 3.73 mm and 24.06 ± 1.66 mm, and for the brown was 66.80 ± 3.09 mm, 71.69 ± 3.73 mm and 23.88 ± 1.15 mm, respectively. Tissues including the gonad, mantle, gill and adductor muscle (Figure 1C) were sampled and homogenized with the QiaShredder (Qiagen, Germany) for total RNA extraction using the Qiagen RNeasy (Qiagen, Germany) kit. mRNA was then purified by using the Qiagen Oligotex mRNA purification kit. Equal amounts of mRNA from four tissues were pooled for either an “orange” or a “brown” scallop sample. From the two pooled samples, about 600 ng mRNA was used for cDNA generation with the SMART cDNA synthesis kit (Clontech Laboratories, USA). Quality control in each extraction step was investigated using gel electrophoresis and nanodrop spectrophotometry (Peqlab, Germany). Both orange and brown scallop cDNAs were further checked with a Bioanalyzer 2100 (Agilent Technologies, USA). As a result, two cDNA libraries (one for orange scallop and the other for brown scallop) with an average length of 400 bp were generated according to the manufacturers’ protocol and sequenced on a 454 Genome Sequencer system (Roche Life Sciences, USA) with FLX and Titanium chemistry.
All sequence reads taken directly from the 454 GS-FLX sequencer were run through the sff file program (Newbler v2.6, Roche) to remove sequencing adapters A and B. Barcodes were removed by Seqclean (Lastest86_64) program and poor sequence data were further cleaned by Lucy v1.20 program (–m 50 –e 0.03 0.03 –w 30 0.03 10 0.1 –b 4 0.03). Sequences with homopolymers of a single nucleotide occupying 60% of the read and those less than 50 nucleotides in length were discarded. Trimmed sequences from orange or brown scallop were mixed and then assembled de novo using the default parameters of Newbler v2.6 (Roche). All C. nobilis EST (expressed sequence tags) sequences were submitted to NCBI Sequence Read Archive under Accession No. SRX253988. ESTs that did not form isotigs (singletons) and isotigs resulting from the assembly of multiple sequences were referred to as unique sequences. These unique sequences were translated into six reading frames and used as a query to search the public databases including Non-redundant protein database (Nr) and Swiss-Prot database (Swiss-Prot). All unique sequences were sequentially compared using BlastX (cut-off E-value of 1e-5) with the sequences in two public protein databases (Nr and Swiss-Prot). Once a sequence had a blast hit in one of the databases, a description was built from the description of that hit. Additionally, Gene Ontology (GO) terms were deduced from the blast results using Blast2GO, and sorted into the immediate subcategories for ‘molecular function’, ‘cellular component’ and ‘biological process’.
All EST sequences were searched for SSR motifs using the MISA (MIcroSAtellite identification) program (http://pgrc.ipk-gatersleben.de/misa/). Default settings were employed to detect perfect di-, tri-, tetra-, penta-, and hexa-nucleotide motifs (including compound motifs). To be assigned, di-nucleotide SSRs (Simple Sequence Repeats) required a minimum of 6 repeats, and all other SSR types needed a minimum of 5 repeats. Two neighboring SSRs with the maximum interruption no more than 100 nucleotides were considered as a compound SSR.
Multiple nucleotide sequence alignments of isotigs identified among the EST libraries were undertaken to identify putative SNPs. Since few reference sequences were available, SNPs were identified as superimposed nucleotide peaks where 2 or more reads contained polymorphisms at the variant allele. SNPs were identified using default parameters in gsMapper v2.3 (Roche) to align isotigs from two color datasets. In addition, only an overall transition vs transversion (Ts/Tv) ratio was calculated across the dataset. Perl script modules linked to the primer modeling software Primer3 were used to design PCR primers flanking for each unique SNP region identified.
From public databases, we compiled a dataset of the 15 known gene involved in carotenoid deposition were collected (Table 1). The amino-acid sequences of the known carotenoid deposition genes, covering carotenoid absorption, transport and cleavage, were used to search (tBlastn) for homologues in 454-derived sequences. Those sequences with scores more than or equal to 100 and E values less than or equal to 1e-10 were clustered to develop unigenes, and all of the unigenes were considered as candidate transcripts. The resulting unigenes were in turn used to search the GenBank databases by BlastX to confirm their putative carotenoid-related functions.
Expression of selected transcripts was investigated in adductor muscle from 6 orange scallop or 6 brown scallops at 14-month old, and two technical replicates were performed for each scallop. All scallops used in this experiment were from a F2 generation as described above, and cultured in the same cage. Total RNA was extracted and quality and quantity determined using a nanodrop spectrophotometer. 1 μg mRNA was used to synthesize cDNA by PrimeScript RT reagent kit with gDNA Eraser (TaKaRa). Quantitative real-time RT-PCR was conducted in a LightCycler®480 System using the SYBR Premix Ex Taq II qRT-PCR Kit (TaKaRa). Each assay was performed with β-actin mRNA as the internal control. The real-time PCR program was 95°C for 30s, followed by 40 cycles of 95°C for 5 s, and 60°C for 30s according to the instructions of the manufacturer. Dissociation analysis of amplification products was performed at the end of each PCR reaction to confirm that only one PCR product was amplified and detected. The comparative CT method (2-ΔΔCT method) was used to analyze the expression level of each candidate genes. All data were given in terms of relative mRNA expressed as means ± SE. The data were subjected to analysis of one-way ANOVA, and p-values smaller than 0.05 were considered statistically significant.
Four scallop lines derived from orange parents, which have color segregation of orange and brown, were chosen to performed this experiment. In total, 80 scallops (40 orange and 40 brown), derived from 4 lines produced by crossing two orange scallops in the Spring of 2012, were used to detect the presence of SRB-3-like in the blood and determine total carotenoid content in the adductor muscle. Presence of SRB-3-like in the blood was detected using primers S3F1: CGATTTTGGAACGGTAACAGTAACTTGGA and S3R1: ATGGATTGACTGATGTGAGATGT. PCR amplification product was confirmed by sequencing. Total carotenoid content in the adductor muscle was determined using the method of Zheng et al. [27].
SRB-like-3 gene was amplified through PCR with noble scallop cDNA as template and 1Fi and 1Ri as primers (Table 2). The PCR products were separated, purified, ligated with vector pMD-18 T (Takara), and transformed into DH5α E. coli cell. The plasmid was extracted using MiniBEST Plasmid Purification Kit Ver.4.0 (Takara) according to the manufacturer’s protocol.
For dsRNA synthesis, SRB-like-3 was amplified by PCR with the primers 2Fi and 2Ri (containing T7 promoter) using the recombinant plasmid pMD-18 T-SRB as the template and (Table 2). Similarly, for dsRNA synthesis of EGFP gene [30], plasmid pEGFP-N1 was used as the template for PCR using EGFPF and EGFPR as the primers. Quantity and quality of the DNA fragments were assessed by nanodrop spectrophotometry and electrophoresis in 1.0% agarose gel. dsRNA was synthesized in vitro using MEGAscript RNAi Kit (Life Technology) following the manufacturer’s protocol. After being incubated at 75°C for 5 min, dsRNA was cooled to room temperature, digested with DNase and RNase, and purified.
Forty orange scallops were used, and each of them was injected with 40 μg dsRNA of SRB-like-3 or EGFP gene (as a control) into the adductor muscle. Scallops were labeled and placed in a cage. The blank group was injected with Rnase-free water. Five individuals were sampled at 3, 6, 12, and 24 h for each group. Adductor muscle muscle, blood and intestine were subjected to total RNA extraction. Real-Time PCR was performed as described above with 2 technological replicates for each sample.
Orange scallops were randomly chosen, and 20 of them were injected with dsRNA of SRB-like-3 or EGFP gene, 5 of them were injected with RNA-free water as the blank group. 24 h later, they were injected again. 12 h after the second injection, 5 scallops from Rnase-free water group, 10 scallops from dsSRB-like-3 group, and 10 scallops from dsEGFP group were sampled. 1 ml blood from each scallop was freeze-dried and added with 0.5 ml acetone to extract caroteoid for about 2-4 h at darkness. Caroteoids from adductor muscle were extracted according to method by Zheng et al. [27]. The samples were always under N2 until measurement of absorption at 480 nm to determine their carotenoid content.
