欢迎光临
我们一直在努力

mrxa是什么感染HLTF disrupts Cas9-DNA post-cleavage complexes to allow DNA break processing

The Streptococcus pyogenes (Sp) Cas9 expression vector, pMJ92271 (Addgene #78312) encodes for Cas9 tagged with hexahistidine and maltose binding protein tags at the N-terminal (6xhis-MBP) and with HA, GFP and three nuclear localization signals at the C-terminal (HA-2xNLS-GFP-NLS). A TEV protease cleavage site is present between the 6-his-MBP tag and Cas9, allowing the removal of the N-terminal tag. Point mutations for nickases (Cas9_D10A, Cas9_H840A) and catalytically dead Cas9 (Cas9_D10A, H840A) were introduced by inverse PCR and confirmed by DNA sequencing. The Francisella novicida (Fn) Cas12a was expressed using pDS01572. Moraxella bovoculi (Mb) (WP_052585281) Cas12a gene was sourced as synthetic genes, codon optimized for Escherichia coli (E. coli) (GeneArt, Thermo Fisher Scientific), and cloned into the pET-1B expression vector (Addgene plasmid #29653) by LIC generating the pMS026 expression construct (6xHis-TEV-MbCas12a). Cas9 and Cas12a were purified using NiNTA affinity chromatography, a heparin purification step, and size exclusion chormatography30,52,73,74. In brief, Cas9 and Cas12a constructs were expressed in E. coli BL21 Rosetta2 (DE3) cells (Novagen). Cells were lysed by ultrasonication in lysis buffer containing 20 mM Tris pH 8, 500 mM NaCl, 5 mM imidazole, 1 µg/ml Pepstatin and 200 µg/ml AEBSF. Clarified lysate was applied to a 10 ml NiNTA (Sigma-Aldrich) affinity column. The column was washed with 20 mM Tris pH 8.0, 500 mM NaCl, 10 mM imidazole, and bound protein was eluted with an imidazole gradient to 250 mM. Eluted protein was dialyzed against 20 mM HEPES pH 7.5, 250 mM KCl, 10% glycerol, 1 mM dithiothreitol, 1 mM EDTA (Cas9), or 20 mM HEPES pH 7.5, 250 mM KCl, 1 mM dithiothreitol, 1 mM EDTA (Cas12a) overnight at 4 °C in the presence of TEV protease to remove the 6xhis-MBP (Cas9) or 6xhis (Cas12a) affinity tags. The cleaved protein was loaded on a HiTrap HP Heparin column (Cytiva) and eluted with a linear salt gradient to 1 M KCl. The elution fractions containing the protein were pooled, concentrated, and loaded on a size exclusion Superdex 200 (16/600) column (Cytiva) in 20 mM HEPES-KOH pH 7.5, 500 mM KCl, 1 mM dithiothreitol yielding pure, monodisperse proteins. The protein was aliquoted, flash-frozen in liquid nitrogen, and stored at −80 °C.

Unless indicated otherwise, all proteins purified from Spodoptera frugiperda cells (Sf9, repository of the Institute of Molecular Cancer Research, Zurich, Switzerland) were expressed for 52 h using recombinant baculoviruses obtained from the indicated vectors using the Bac-to-bac system (Invitrogen) following manufacturer’s instructions. The cells were collected, washed with PBS 1× (Gibco), frozen in liquid nitrogen, and stored at −80 °C until the day of the purification. The Saccharomyces cerevisiae Mre11-Rad50-Xrs2 (MRX) complex was expressed in in Spodoptera frugiperda 9 (Sf9) cells using pTP39175 (a kind gift of Tanya Paull, University of Texas at Austin), expressing his-tagged Mre11, pFB-Rad50, expressing codon-optimized untagged Rad5076 and pTP69475 (Tanya Paull, University of Texas at Austin) expressing Xrs2-FLAG and purified by sequential NiNTA (Qiagen) and FLAG (Sigma) affinity purification77. The Mre11-Rad50 (MR) complex was expressed as the MRX complex with the omission of the baculovirus expressing Xrs2, and purified by NiNTA affinity chromatography followed by ion exchange chromatography (HiTrap SP HP and HiTrap Q HP columns, both Cytiva) on an AKTA system50. Phosphorylated Sae2 (pSae2) was expressed in Sf9 cells using the pFB-MBP-Sae2-his construct and purified by amylose and NiNTA affinity chromatography with phosphatase inhibitors1,78. The MBP-tag was removed by digestion with PreScission Protease.

The human MRN complex was purified from Sf9 cells using the pTP1779, pFB-RAD50-FLAG2, and pTP3679 vectors coding for MRE11-6xhis, RAD50-FLAG, and NBS1, respectively (pTP17 and pTP36 were provided by Tanya Paull, University of Texas at Austin, Austin, TX), and purified by NiNTA and FLAG affinity purification2. Phosphorylated CtIP (pCtIP) was purified by amylose and NiNTA purification from cells infected with baculovirus produced from the pFB-MBP-CtIP-his vector2. The MBP tag was removed by PreScission Protease before the NiNTA purification step.

The construct for the expression of his-tagged dimeric LacI, pMALT-P_LacI(1-340)_6xhis, was produced by cloning into a pMALT-P vector (Kowalczykowski laboratory, UC Davis) the coding region for LacI (amino acids: 1 to 340) obtained by PCR from the pMALT-P vector with the following primers: LacI-for and LacI_6xhis-rev (see Supplementary Table 1 for primer sequences). The LacI_6xhis-rev primer added a sequence coding for in-frame 6xhis tag to the C-terminus of the protein. The construct was transformed in BL21 (DE3) pLysS cells and the culture was grown overnight at 37 °C. Expression was induced at an OD of 1.5 with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) for 3 h at 37 °C. Cells were harvested by centrifugation at 3000 × g for 15 min, washed with cold PBS, and centrifuged again at 3000 × g for 15 min. The pellet was snap-frozen in liquid nitrogen and stored at −80 °C until processing. All subsequent steps were performed at 4 °C. For purification, the pellet was resuspended in NiNTA Wash Buffer containing 50 mM Tris-HCl pH 7.5, 1 mM dithiothreitol, 10% glycerol, 500 mM NaCl and 1 mM phenylmethylsulfonyl fluoride (PMSF), supplemented with protease inhibitor cocktail (P8340, Sigma-Aldrich, 1:300). The mixture was sonicated, and the soluble extract was cleared by centrifugation for 30 min at 50,000 × g at 4 °C and filtered with 0.44 µM filters. The clarified soluble extract was loaded on a pre-equilibrated 1 ml HisTrap HP column (Cytiva) and washed with NiNTA Wash Buffer and later with NiNTA Wash Buffer supplemented with 20 mM imidazole. The protein was eluted in 250 µl fractions with a 5 ml gradient, from 20 to 300 mM imidazole. The fractions containing the protein were pooled and desalted using a HiTrap Desalting column (Cytiva) equilibrated in Buffer A (50 mM Tris-HCl pH 7.5, 1 mM dithiothreitol, 10% glycerol, 50 mM NaCl and 1 mM PMSF). The desalted protein was loaded on a HiTrap Heparin column (Cytiva) and washed extensively with Buffer A to remove the IPTG bound to the protein. Dimeric LacI was eluted with a 10 ml salt gradient in buffer A (from 50 to 1 M NaCl), collecting 250 µl fractions. The fractions containing the protein were pooled, aliquoted, and snap-frozen. The concentration in monomers was calculated by measuring the absorbance at 280 nm using a predicted molar extinction coefficient of 23045 M−1 cm−1.

The Saccharomyces cerevisiae Ku heterodimer (Ku70-Ku80) was expressed in Sf9 insect cells infected using pFB-MBP-Ku70-his and pFB-Ku80-FLAG coding for MBP- and his-tagged Ku70 and FLAG-tagged Ku80, respectively. The complex was purified using amylose and FLAG affinity resins7. The MBP tag was removed before the FLAG purification step using PreScission Protease.

The sequences coding for Dnl4 and Lif1 were amplified by PCR from Saccharomyces cerevisiae genomic DNA (yWH436 strain80) using FlagDNL4FO with FlagDNL4RE and LIF1FO with LIF1RE, respectively. The products were digested using BamHI-XmaI (Dnl4) and NheI-XhoI (Lif1), and inserted into pFB-MBP-Sgs1 digested with same enzymes to generate pFB-MBP-Lif1 and pFB-FLAG-Dnl4, respectively. Dnl4 and Lif1 were coexpressed, and the complex was purified with the same procedure used for the Ku complex, except cleavage with PreScission Protease was performed using a 1:4 [w/w] ratio of PreScission Protease to Dnl4-Lif1 instead of the 1:5 [w/w] ratio used for the Ku complex.

Saccharomyces cerevisiae Nej1 was expressed in Sf21 insect cells (sourced from the European Molecular Biology Laboratory, Grenoble, France) with a 10xhis tag on its N-terminus using the Nej1_pFL vector81. The cell pellet was suspended in lysis buffer containing 25 mM Tris-HCl pH 8.0, 150 mM NaCl, 150 mM KCl, 10 mM β-mercaptoethanol, 50 mM imidazole, protease inhibitor cocktail (cOmplete EDTA free, Roche, ½ tablet for 250 ml of lysis buffer) and sonicated by three cycles of 1 min at 60% amplitude. The lysate was supplemented with benzonase (0.04 U/ml) and 1 mM magnesium chloride, incubated for 15 min, and centrifuged at 50,000 × g for 30 min. The supernatant was incubated for 1 h at 4 °C under agitation with NiNTA resin pre-equilibrated with the lysis buffer. The resin was washed three times with 50 ml of washing buffer containing 25 mM Tris-HCl pH 8.0, 150 mM KCl, 850 mM NaCl, 10 mM β-mercaptoethanol, and 50 mM imidazole. The protein was eluted using elution buffer containing 25 mM Tris-HCl pH 8.0, 150 mM KCl, 150 mM NaCl, 10 mM β-mercaptoethanol, and 300 mM imidazole. The elution fractions were dialyzed at 4 °C against QA buffer containing 25 mM Tris-HCl pH 8.0, 100 mM KCl, 10 mM β-mercaptoethanol, and 10 mM EDTA using a 6–8 kDa cutoff dialysis membrane. The dialyzed sample was then loaded onto a 6 ml Resource Q column (Cytiva). The flow-through containing the protein of interest was dialyzed overnight at 4 °C against 1 l of storage buffer containing 25 mM Tris-HCl pH 8.0, 75 mM NaCl, 75 mM KCl, 10% glycerol, 5 mM β-mercaptoethanol and snap-frozen in liquid nitrogen.

Yeast Exo1 was purified from Sf9 cells using the pFB-Exo1-FLAG vector by FLAG affinity and HiTrap SP HP (Cytiva) ion exchange chromatography77. Yeast Rad54 and Pif1 were purified from E. coli cells using the pMALT-FLAG-Rad54 and pMALT-FLAG-Pif1 constructs by FLAG affinity purification82.

Sgs1, BLM, WRN, Mer3, and HLTF were expressed from Sf9 insect cells pFB-MBP-Sgs1, pFB1-MBP_BLM-wt_his, pFB1-MBP_WRN-wt_his, pFB_MBP_Mer3_his and pFastBac-2XMBP-hHLTFco-his vectors and purified by amylose affinity purification, followed by PreScission Protease removal of the N-terminal MBP tag (2xMBP for HLTF) and NiNTA affinity purification83,84,85,86.

The sequence coding for human PIF1 was purchased from GenScript (see Supplementary Table 2 for synthetic gene sequences) and cloned into pFB-MBP-Sgs1-his using NheI and XmaI to generate pFB_MBP-hPIF1co_his. The sequence for the expression of human HELQ was amplified by PCR from the pFB-hHELQ-his87 vector (a gift from Richard Wood) using NheI-hHELQ-FP and XmaI-hHELQ-RP (see Supplementary Table 1 for oligonucleotide sequences) and cloned into pFB1-MBP_WRN-wt_his via NheI and XmaI, using standard procedures to generate pFB-MBP-hHELQ-his. Human PIF1 and human HELQ were expressed in Sf9 cells and purified via amylose (New England Biolabs) and NiNTA (Qiagen) affinity chromatography as described for Sgs1. The MBP tag was removed by PreScission protease digestion.

SMARCAL1, ZRANB3, and HROB were purified by FLAG affinity chromatography from Sf9 insect cells with the pFB-FLAG-SMARCAL1, pFB-FLAG-ZRANB3-WT, and pFB-HROB-FLAG constructs86,88. The phosphorylated MCM8-MCM9 complex was obtained by co-expressing FLAG-tagged MCM8 and MBP-tagged MCM9 in the presence of 50 nM Okadaic acid with the pFB-FLAG-MCM8 and pFB-MBP-MCM9 plasmids and purified by amylose and FLAG affinity purification88,89. 50 nM Okadaic acid (APExBIO), 1 mM sodium orthovanadate (Sigma), 20 mM sodium fluoride (Sigma), and 15 mM sodium pyrophosphate (Applichem) were added to the lysis buffer to preserve the phosphorylation status89.

The sequence coding for human RAD54 fused to a C-terminal FLAG-tag was codon optimized and purchased from GenScript (see Supplementary Table 2 for synthetic gene sequences) and cloned into pFB-MBP-Sgs1-his with NheI and HindIII, generating pFB_MBP-TEV-hRAD54co-FLAG. A TEV cleavage site is present at the N-terminus of RAD54 for the removal of the MBP-tag. RAD54 was expressed in Sf9 cells with pFB_MBP-TEV-hRAD54co-FLAG. The protein was then purified by amylose and FLAG affinity purification as described for the Ku complex with some important modifications. First: the lysis buffer contained 5 mM β-mercaptoethanol instead of DTT. Second: after binding the protein on the amylose resin, a wash with wash buffer with 1 M NaCl was added. Third: the MBP-cleavage was performed using TEV protease (1:2.5, [w/w] ratio of TEV protease to protein) for 50 min at 4 °C, 10 min at room temperature, 50 min at 4 °C, and one last incubation for 10 min at room temperature. Fourth: the buffers used for the FLAG purification step contained 250 mM NaCl instead of 150 mM.

For the expression of FANCJ in Sf9 cells, the sequence of the protein was amplified from the BACH1-PVL1392 vector (a gift from Lumír Krejčí, Masaryk University)90 using the FANCJ_to_pFB_for and FANCJ_to_pFB_rev oligonucleotides (see Supplementary Table 1 for oligonucleotide sequences), digested with BsaI and inserted into pFB-Rad50co (digested with BamHI and XhoI) to generate pFB-FLAG-FANCJ. The cell pellet was resuspended with 3 volumes of lysis buffer containing 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 5 mM β-mercaptoethanol, 1 mM PMSF, 30 μg/ml leupeptin, and protease inhibitor cocktail (P8340, Sigma-Aldrich, 1:300) and let to swell on ice for 20 min. 50% glycerol and 5 M NaCl were added to a final concentration of 16.5% and 305 mM, respectively. Lysis was allowed to proceed for 30 min in agitation at 4 °C. The lysate was clarified by centrifugation at 50,000 × g for 30 min at 4 °C and incubated while mixing for 1 h with FLAG resin (Sigma). The resin was washed extensively with was buffer containing 50 mM Tris-HCl pH 7.5, 250 mM NaCl, 0.5 mM β-mercaptoethanol, 0.5 mM PMSF, 10% glycerol and 0.1% NP40. One last wash was performed with wash buffer without NP40, and the protein was eluted with wash buffer without NP40 supplemented with 5 μg/ml 3XFLAG peptide (GLPBIO). The fractions containing FANCJ were pooled, aliquoted, snap-frozen in liquid nitrogen, and stored at −80 °C until use.

The coding sequence for FANCM was codon optimized for insect cell expression and purchased from Twist Biosciences in two separate synthetic genes termed FANCM_N and FANCM_C (see Supplementary Table 2 for synthetic gene sequences). The synthetic sequences were digested with NheI-AflII (FANCM_N) and AflII-HindIII (FANCM_C) and assembled into pFastBac-2XMBP-hHLTFco-his digested with NheI and HindIII to generate the pFastBac-2XMBP-hFANCMco-his vector. FANCM was expressed in Sf9 insect cells for 52 h. The cells were pelleted, washed with 1× PBS, snap-frozen, and stored at −80 °C until further use. For the purification, which was carried out entirely at 4 °C or on ice, the pellet was resuspended in three volumes of lysis buffer containing 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 5 mM β-mercaptoethanol, 2 mM PMSF, 50 μg/ml leupeptin and protease inhibitor cocktail (P8340, Sigma-Aldrich, 1:200) and incubated in agitation for 5 min at 4 °C. After incubation, one-half volume of 50% glycerol was added to the mixture, followed by 6.5% volume of 5 M NaCl (final concentration 305 mM) and extraction was carried out for 25 min at 4 °C. The soluble extract was obtained by centrifugation of the extract at 50,000 × g for 30 min at 4 °C and incubated in agitation for 1 h with amylose resin (New England Biolabs) pre-equilibrated with lysis buffer supplemented with glycerol and NaCl. The resin was washed 2 times batchwise and then extensively on a disposable plastic column (Pierce) with wash buffer containing 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 5 mM β-mercaptoethanol, 10% glycerol, 1 mM PMSF, and 1 M NaCl. The concentration of salt was progressively lowered by washing the resin with wash buffer containing 300 and 150 mM NaCl (one column volume each). The protein was eluted with 150 mM wash buffer supplemented with 10 mM maltose. The eluted protein was quantitated by Bradford assay and incubated with a 1:5 [w/w] ratio of PreScission Protease to protein for 1 h at 4 °C to remove the 2xMBP-tag. After the incubation, the protein was diluted with buffer R containing 50 mM Tris-HCl pH 7.5, 5 mM β-mercaptoethanol, 10% glycerol, and 1 mM PMSF to lower the salt to 100 mM and loaded onto a 1 ml HiTrap Q HP column (Cytiva). The protein was washed with 20 ml buffer R at 100 mM NaCl and eluted from the column with a salt gradient in buffer R from 100 mM to 1 M NaCl. The fractions containing the protein were pooled, aliquoted, and snap-frozen.

The HLTF N90A-N91A (NANA) was purified as the WT protein using pFastBac-2XMBP-hHLTFco-his-NANA. The expression vector was generated from the pFastBac-2XMBP-hHLTFco-his vector by mutagenesis using QuikChange II XL Site-Directed Mutagenesis Kit (Agilent) according to the manufacturer’s instructions using HLTF_NANA_for/HLTF_NANA_rev (see Supplementary Table 1 for primer sequences). For the expression of the HLTF HIRAN domain variants (WT and NANA), the first 180 amino acids of HLTF were amplified from the pFastBac-2XMBP-hHLTFco-his vector (WT and NANA) by PCR using the primers HLTF_1-180_for and HLTF_1-180_rev (see Supplementary Table 1 for primer sequences) and inserted in the pFastBac-2XMBP-HLTF-his in place of the full-length protein, creating pFastBac-2XMBP-HIRAN-his and pFastBac-2XMBP-HIRAN-his-NANA. Expression and purification were performed following the same procedure used for the full-length proteins except the MBP tag was not removed.

Human RPA was expressed in Sf9 insect cells with the pFB-RPA1, pFB-RPA2, pFB-6xhis-RPA3 vectors and purified by NiNTA affinity chromatography, on a HiTrap Blue column (Cytiva) followed by desalting with a HiTrap Desalting column (Cytiva) and finally onto a HiTrap Q column (Cytiva)91,92,93. Yeast RPA was expressed in BL21 (DE3) pLysS cells and purified on a HiTrap Blue column (Cytiva), HiTrap Desalting column (Cytiva) and a HiTrap Q column (Cytiva)91.

Srs2 and Mph1 were gifts from Lumír Krejčí (Masaryk University)94,95. RECQ5 and FBH1 were provided by Pavel Janscak (University of Zürich)96,97. Chd1 was obtained from Beat Fierz (EPFL, Lausanne)98. The FACT complex (hSpt16-SSRP1) was a kind gift from Jacob Corn (ETH Zürich)99.

crRNA (CD.Cas9.GJXV6830.AD) and tracrRNA for Cas9 targeting were purchased from Integrated DNA Technologies (see Supplementary Table 1 for oligonucleotide sequences) and annealed at equimolar concentrations (10 µM final) in IDTE buffer pH 8.0 (Integrated DNA Technologies) according to manufacturer’s instructions. The Cas12a crRNA (pUC19_Cas12a_1, see Supplementary Table 1 for sequence) was used without further modifications. 1 µM (final) Cas9 and Cas12a variants were incubated with a three-fold excess of the RNA component (annealed crRNA-tracrRNA for Cas9 and crRNA for Cas12a) in RNP buffer containing 25 mM Tris-HCl pH 7.5, 5 mM magnesium chloride, 1 mM dithiothreitol, 0.25 mg/ml bovine serum albumin, BSA and 150 mM KCl for 10 min at 25 °C to produce the respective RNPs. After incubation, the RNPs were subaliquoted, snap-frozen in liquid nitrogen, and stored at −80 °C for later use.

The plasmids used for the in vitro assays are derivatives of pUC19 (see Supplementary Table 1 for a list of plasmids used in this study). The pUC19_0x_LacO plasmid was obtained by inserting the annealed oligonucleotides Even_A and Even_B into pUC19 digested with HindIII and AflIII (see Supplementary Table 1 for oligonucleotide sequences). pUC19_1x_LacO (used for the experiments in Fig. 2a–c) was produced inserting the oligonucleotides Even(WT)_1 and Even(WT)_2 into the BbsI site of pUC19_0x_LacO. The linear, nicked circular 1, and nicked circular 2 versions of the substrate used in Fig. 2a–c were obtained by digestion of pUC19_1x_LacO with EcoRV (New England Biolabs), Nt.BstNBI and Nb.BbvCI, respectively. The substrates with open- and loop-end used for experiments in Fig. 2d–f and Supplementary Fig. 2b were produced from the pAttP-S plasmid using the ΦC31 integrase with Open_int_LacO_TOP annealed to Open_int_LacO_BOT, or with self-annealed Hairpin_integrase_LacO, respectively (see Supplementary Table 1 for oligonucleotide sequences)92.

The pUC19_0xLacO_Cas substrate used for Cas9 and Cas12a nuclease experiments was obtained by site-directed mutagenesis (QuikChange II XL Site-Directed Mutagenesis Kit, Agilent) with pUC19_0xLacO_Cas_FOR and pUC19_0xLacO_Cas_REV primers (see Supplementary Table 1 for oligonucleotide sequences). The substrate with the inverted target guide site used in Supplementary Fig. 3a (pUC19_0xLacO_Cas_rev) was obtained by replacing the portion of pUC19_0xLacO_Cas between HindIII and PstI sites with annealed oligonucleotides pUC19_0xLacO_Cas_rev_oligo1 and pUC19_0xLacO_Cas_rev_oligo2. The substrate for the in vitro ligation assay was prepared by PCR from the pUC19_0xLacO_Cas plasmid with primers pUC19_0xLacO_Cas_1kb_for and pUC19_0xLacO_Cas_1kb_rev, according to standard procedures (see Supplementary Table 1 for oligonucleotide sequences). [α-32P]dCTP (Hartmann Analytic) was added to the PCR reaction in order to label the substrate radioactively.

The oligonucleotide-based substrate for the assay presented in Fig. 3c was prepared by labeling Cas9_target1_FO oligonucleotide (see Supplementary Table 1 for oligonucleotide sequence) at the 5′-end with T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP (Hartmann Analytic). After labeling, the oligonucleotide was purified on a Micro Bio-Spin P-30 Gel Column (Bio-Rad). The labeled oligonucleotide was then annealed with a 2-fold excess of Cas9_target1_RE oligonucleotide (see Supplementary Table 1 for oligonucleotide sequence) in annealing buffer (10 mM Tris-HCl pH 8, 50 mM NaCl, 10 mM magnesium chloride), heated to 95 °C for 3 min and cooled down to room temperature overnight. The oligonucleotide-based substrate for the assay presented in Supplementary Fig. 7f was prepared by labeling Cas9-TOP (see Supplementary Table 1 for oligonucleotide sequence) at the 5′-end and annealed with a 2-fold excess of Cas9-BOT (see Supplementary Table 1 for oligonucleotide sequence) as described above.

The mobile Holliday junction substrate (see Supplementary Table 1 for oligonucleotide sequences)86 was prepared by annealing 3′-labeled XO2 with XO1 (1:1.2 ratio) in annealing buffer (10 mM Tris-HCl pH 8, 50 mM NaCl, 10 mM magnesium chloride) by heating for 3 min at 95 °C and slowly cooling down the mix to room temperature overnight. At the same time, XO1c.MM2 and XO2c.MM oligonucleotides (1.2:1.2 ratio compared to the labeled oligonucleotide) were annealed as described above. The next day, the mixes were combined and incubated for 30 min at 37 °C and cooled down to room temperature for 2 h. XO2 was 3′-end labeled using Terminal Transferase (New England Biolabs) and [α-32P]dCTP (Hartmann Analytic) according to the manufacturer’s instructions and purified on Micro Bio-Spin P-30 Gel Columns (Bio-Rad).

DNA binding experiments with the MR complex and the various substrates in Supplementary Fig. 2a were performed in binding buffer containing 25 mM Tris-acetate pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 1 mM ATP-γ-S (BIOLOG), 0.25 mg/ml bovine serum albumin (New England Biolabs) and 1 nM substrate, in a final volume of 15 µl. The MR complex was added at the indicated final concentration to the mix and incubated for 15 min a 30 °C. After the incubation, 5 µl EMSA loading dye (50% glycerol with bromophenol blue) was added to the reaction, which was loaded on a 0.6% agarose gel and run at 4 °C. At the end of the run, the gel was stained with GelRed (Biotium) and imaged with a Typhoon Imager (Cytiva).

DNA binding experiments with Cas9 and the HIRAN variants in Supplementary Fig. 7f were performed in binding buffer containing 25 mM Tris-acetate pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 0.25 mg/ml bovine serum albumin (New England Biolabs), 50 mM potassium chloride and 1 nM substrate, in a final volume of 15 µl. The substrate was incubated with 5 nM Cas9 HA or DA for 30 min a 30 °C, as indicated. Reactions were moved on ice, supplemented with the indicated concentration of HLTF HIRAN domain WT or NANA mutant, and incubated for 10 min at 37 °C. After the incubation, 5 µl EMSA loading dye (50% glycerol with bromophenol blue) was added to the reaction. The DNA-protein complexes were separated on a 0.6% agarose gel and run at 4 °C. The gel was dried on DE81 chromatography paper (Whatman), exposed to phosphor screens, imaged with a Typhoon Imager, and quantitated using ImageJ Software (1.53 g). Plots were generated with Graph Pad Prism 10.2.2 (397).

Nuclease assays with Exo1 were performed in reaction buffer containing 1 nM (in molecules) of DNA substrate, 25 mM Tris-acetate pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 1 mM manganese chloride, 1 mM ATP, 80 U/ml pyruvate kinase (Sigma), 1 mM phosphoenolpyruvate, 50 mM KCl and 0.25 mg/ml bovine serum albumin (New England Biolabs), in a final volume of 15 µl. For experiments in Supplementary Fig. 6, reactions contained 237 nM yeast RPA. The substrate was incubated with the indicated amounts of EcoRV, Cas12a, or Cas9 variants for 10 min at 37 °C. Reactions were moved on ice, supplemented with Exo1 and HLTF, as indicated and incubated for 30 min at 30 °C. The samples were supplemented with 5 µl of 0.2% STOP solution (150 mM EDTA, 0.2% SDS, 30% glycerol, and 1 mg/ml bromophenol blue) and deproteinated with 1 µl of 14–22 mg/ml Proteinase K (Roche) for 1 h at 37 °C. The stopped reactions were separated on 1% agarose gels stained with GelRed (Biotium), imaged with a Typhoon Imager (Cytiva), and quantitated using ImageJ Software.

Annealing DNA end resection assays with MR-pSae2 were performed in reaction buffer containing 1 nM (in molecules) of the indicated DNA substrate, 25 mM Tris-acetate pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 1 mM manganese chloride, 1 mM ATP, 80 U/ml pyruvate kinase (Sigma), 1 mM phosphoenolpyruvate, 50 mM KCl (omitted for experiments in Fig. 2) and 0.25 mg/ml bovine serum albumin (New England Biolabs), in a final volume of 15 µl. For experiments in the presence of LacI, the substrate was incubated with 84 nM LacI (in monomers) for 5 min at 30 °C. The reaction was then moved on ice. Unless indicated otherwise, 25 nM Mre11-Rad50 (MR) or Mre11-Rad50-Xrs2 (MRX) complexes and 200 nM phosphorylated Sae2 (pSae2) were added, and the reactions were further incubated for 30 min at 30 °C. The reactions with human MRE11-RAD50-NBS1 (MRN, 40 nM) complex and phosphorylated CtIP (pCtIP, 100 nM) were incubated at 37 °C for 1 h, unless stated otherwise. The reactions were stopped with 5 µl of 2% STOP solution (30 mM EDTA, 2% SDS, 30% glycerol, and 1 mg/ml bromophenol blue) and 1 µl of 14–22 mg/ml Proteinase K (Roche). Deproteination was carried out for 1 h at 37 °C. Subsequently, the stopped reaction was supplemented with 6.5 mM final magnesium acetate and a three-fold excess of the radioactive probe (Probe 1 except for the left panel in Fig. 3a and Supplementary Fig. 3a for which Probe 2 was used, see Supplementary Table 1 for the sequences), heated to 60 °C for 3 min and slowly cooled overnight to let the probe anneal to the resected DNA. The probe was previously radioactively labeled at the 5′-end using T4 polynucleotide kinase (New England Biolabs) and [γ-32P]ATP (Hartmann Analytic) and purified on Micro Bio-Spin P-30 Gel Columns (Bio-Rad). The annealing reactions were separated on 1% agarose gels that were then dried on DE81 chromatography paper (Whatman). The dried gels were exposed to phosphor screens, imaged with a Typhoon Imager, and quantitated using ImageJ Software.

Unless indicated otherwise, for resection of breaks generated by EcoRV, Cas9, or Cas12a, the substrate was incubated with the indicated nuclease(s) for 10 min at 37 °C before the addition of the DNA end resection components. Assays as shown in Fig. 1b were carried out as described above with the following modifications: reactions were stopped after incubation with the Cas9 and Cas12a variants and separated on 1% agarose gels stained with GelRed (Biotium) and imaged with a Typhoon Imager (Cytiva).

For resection experiments performed in the presence of translocases, the indicated proteins were added together with the resection components and incubated as described above. The assays in Supplementary Fig. 4d were performed as described above with a few important modifications. Magnesium chloride was added at a final concentration of 1 mM while manganese chloride was omitted, the indicated concentrations of FANCM and HLTF were incubated with the substrate for 30 min at 37 °C. Additional 4 mM of magnesium chloride and 1 mM manganese chloride were added together with the resection components, and the reactions were performed for 1 h at 30 °C instead of 30 min.

Resection assays carried out in the presence of purified HIRAN domain were supplemented with the HLTF fragment for 10 min at 37 °C before the addition of full-length HLTF and the resection components.

Nuclease assays for detection of multi-turnover behavior of Cas9 variants were performed in 15 µl in reaction buffer containing 1 nM substrate (in molecules), 25 mM Tris-acetate pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 1 mM manganese chloride, 1 mM ATP, 80 U/ml pyruvate kinase (Sigma), 1 mM phosphoenolpyruvate, 50 mM KCl and 0.25 mg/ml bovine serum albumin (New England Biolabs). The substrate was incubated with the indicated amount of Cas9 variant for 10 min at 37 °C. Subsequently, the reaction was supplemented with the indicated amount of the HLTF variant and further incubated for 30 min at 37 °C (2 h for the down-titration of Cas9, Fig. 5c and Supplementary Fig. 5b). For experiments performed in the presence of the HIRAN domain, the indicated amount of the HLTF fragment was incubated with the Cas9-treated substrate for 10 min at 37 °C before the addition of full-length HLTF.

In vitro ligation assays were performed in two steps. First, 1 nM plasmid-length substrate was incubated for 10 min at 37 °C with 0.4 U of EcoRV or 5 nM Cas9 in ligation buffer containing 60 mM Tris-HCl pH 7.5, 5 mM dithiothreitol, 10 mM magnesium chloride, 1 mM ATP, 0.05 mg/ml bovine serum albumin (New England Biolabs), in a final volume of 3 µl. For the second step, the reaction was then supplemented with ligation buffer to a volume of 13 µl to lower the substrate concentration to 0.2 nM. 9 nM Ku complex, and the remaining components of the yeast NHEJ machinery at the indicated concentrations were subsequently added to the reaction, and the samples were incubated for 1 h at 25 °C. Reactions were deproteinated at 50 °C for 1 h after the addition of 5 µl of 2% STOP solution (30 mM EDTA, 2% SDS, 30% glycerol, and 1 mg/ml bromophenol blue) and 1 µl of 14–22 mg/ml Proteinase K (Roche). Samples were separated on a 1.5% agarose gel at 120 V, the gel was then dried on DE81 chromatography paper (Whatman), exposed to phosphor screens and imaged with a Typhoon imager. Ligation efficiency was quantitated using ImageJ Software. For the experiments in Fig. 4e, the substrate was treated with the indicated amount of HLTF for 10 min at 37 °C before the addition of the NHEJ components.

Branch-migration assays were performed in a volume of 15 µl in reaction buffer containing 25 mM Tris-acetate pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 1 mM manganese chloride, 1 mM ATP, 80 U/ml pyruvate kinase (Sigma), 1 mM phosphoenolpyruvate, 0.25 mg/ml bovine serum albumin (New England Biolabs) and 1 nM mobile Holliday Junction substrate (refer to the section Preparation of oligonucleotide-based substrates)86. After the addition of the indicated proteins, the reaction was incubated for 30 min at 30 °C. Branch migration was stopped by the addition of 5 µl of 2% STOP Solution and 1 µl of Proteinase K and incubation for 10 min at 37 °C. Reaction products were separated on 8% TBE (89 mM Tris, 89 mM boric acid, 2 mM EDTA) acrylamide gels. After the run, gels were dried on 17CHR paper (Whatman) and treated as described above.

The dsDNA target was prepared by mixing oligonucleotides TS, NTS, and 22nt-adapter (purchased from Integrated DNA Technologies, see Supplementary Table 1 for oligonucleotide sequences) at 1:1.25:1 ratio in a buffer containing 10 mM Tris-HCl pH 8 and 50 mM NaCl. The oligonucleotides were heated at 95 °C for 1 min, and slowly cooled down to room temperature over 1 h64. For experiments with Alexa750 on the PAM-proximal side of the target DNA, TS was substituted with TS-1 (see Supplementary Table 1 for oligonucleotide sequences). wtCas9 and dCas9 were gifts from the Doudna lab at UC Berkeley. Cas9 H840A nickase was purchased from Applied Biological Materials Inc. (K136). Cas9 D10A nickase was purchased from NEB (M0650T). ATTO550 labeled tracrRNA was purchased from IDT. crRNA was transcribed in vitro using HiScribe™ T7 Quick High Yield RNA Synthesis Kit (NEB, E2050S). TracrRNA and crRNA were annealed to assemble gRNA following manufacturer’s instructions64.

DNA substrates were added into the sample chamber of a quartz microscope slide and immobilized on the surface of the microscope slide via biotin-NeutrAvidin interactions for TIRFM imaging100. The TIRFM sample chamber was maintained at 37 °C throughout the experiment. To assemble Cas9 RNP, 300 nM Cas9 and 100 nM gRNA were mixed in Cas9 imaging buffer (20 mM Tris-HCl pH 8, 100 mM KCl, 5 mM magnesium chloride, 5% [vol/vol] glycerol, 0.2 mg/ml bovine serum albumin (New England Biolabs) and saturated Trolox (>5 mM), 0.8% (w/v) dextrose, 1 mg/ml glucose oxidase, 0.04 mg/ml catalase), and incubated for 10 min at room temperature. Next, the assembled Cas9 RNP was diluted to 20 nM in Cas9 imaging buffer, added into the sample chamber, and incubated for 10 min. After flowing out free Cas9 RNP from the sample chamber using Cas9 imaging buffer, fluorescence signals of more than 1000 molecules were measured to make the “Before HLTF” histograms. Next, 20 nM HLTF in the HLTF reaction buffer (25 mM Tris-HCl pH 7.5, 1 mM dithiothreitol, 5 mM magnesium chloride, 1 mM manganese chloride, 1 mM ATP, 80 U/ml pyruvate kinase [Sigma], 1 mM phosphoenolpyruvate and 0.25 mg/ml bovine serum albumin (New England Biolabs) and 50 mM KCl) was added into the sample chamber and incubated for 30 min (unless otherwise indicated). The HLTF was then flowed out of the sample chamber using Cas9 imaging buffer, and fluorescence signals of >1000 molecules were measured for making the “After HLTF” histograms. For experiments with two fluorophores, the signal intensity ratio is defined as the intensity of Cy5 divided by the total intensity of Cy5 and ATTO550. For experiments with three fluorophores, the signal intensity ratios E21 and E23 are defined as the intensity of ATTO550 divided by the total intensity of Cy5 and ATTO550 (Eq. 1) and the intensity of Alexa750 divided by the total intensity of Cy5 and Alexa750 (Eq. 2), respectively.

MCF10A cells (CRL-10317, ATCC) were cultured in a 1:1 mixture of DMEM and Ham’s F12 medium (Thermo Fisher Scientific), supplemented with 20 ng/ml human epidermal growth factor (Sigma-Aldrich), 10 µg/ml insulin (Sigma-Aldrich), 0.5 µg/ml hydrocortisone (Sigma-Aldrich), 100 ng/ml cholera toxin (Sigma-Aldrich), 5% horse serum (Thermo Fisher Scientific), and Pen-Strep (Gibco). MCF10A DOX inducible nCas9D10A and nCas9H840A cells were constructed infecting MCF10A cells with lentivirus containing Dox-Cas9-D10A and Dox-Cas9-H840A and selected with 10 μg/ml blasticidin101. The guides that target Alu (CAGGCGTGAGCCACCGCGCC) and LINE1 (ATTCTACCAGAGGTACAAGG) elements67 were cloned into the Lenti-Guide-NLS-GFP101 and delivered by lentivirus. After virus infection, MCF10A cells were selected using 3 μg/ml puromycin. For the Western blotting assay, nCas9D10A or nCas9H840A MCF10A cells were treated or not with siRNA targeting HLTF (L-006448-00-0005 Dharmacon Smart pool) for 48 h. Doxycycline was added to the media for 24 h before collection to induce the nickase expression. To obtain whole cell extracts, cells were lysed in Laemmli lysis buffer (4% SDS, 20% glycerol, 125 mM Tris-HCl pH 7.4, 50 mM b-Glycerophosphate disodium, 2 mM PMSF, and 1× Complete Mini EDTA free proteinase inhibitor [Roche]), boiled for 5 min, sonicated for 10 s at amplitude 20% in an Ultrasonic Processor (Cole-Parmer), and centrifuged at 16,000 × g for 10 min. The supernatant was then collected, and 40 µg of total protein was loaded per well in 4–12% Bis-Tris gels (NuPAGE, Invitrogen) and transferred onto nitrocellulose membranes. Primary antibodies were used at the following dilutions: anti-Cas9 (1:1000, Novus Biologicals, NBP280679), anti-HLTF (1:500, Abcam, ab17984), anti-γH2AX (1:5000, pSer 139, Millipore γH2AX (1:5000, pSer 139, Millipore 05-636), anti-pRPA S4/S8 (1:1000, Bethyl Laboratories, Cat# A300-245A), anti-Tubulin (1:5000, Sigma, #T-5168). Except for anti-γH2AX, which was incubated for 1 h at room temperature, all other primary antibodies were incubated overnight at 4 °C. Fluorescent secondary antibody anti-mouse or anti-rabbit IRDye 800CW or 680RD (LI-COR Biosciences) were incubated for 1 h at room temperature. Detection of protein bands was performed by fluorescence imaging using a Li-Cor Odyssey CLx imaging system (Li-Cor Biosciences).

The number of repeats was chosen based on what is common and/or practical in the field. Data points were excluded only when there was a valid reason to do so, such as errors during the assay execution and/or imaging, or failure of experimental apparatuses (e.g. ruined gel wells). The experiments were repeated multiple times, as indicated in the figure legend. The indicated number of repeats in the figure legends refers to biological replicates. Randomization and blinding were prevented by the loading order of the sample. This was nevertheless not a problem as quantification was carried out objectively with dedicated software.

Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.

赞(0)
未经允许不得转载:上海聚慕医疗器械有限公司 » mrxa是什么感染HLTF disrupts Cas9-DNA post-cleavage complexes to allow DNA break processing

登录

找回密码

注册