157 BrCa patients were recruited by the First Affiliated Hospital with Nanjing Medical University and Affiliated Cancer Hospital to Nanjing Medical University (NJMU) from 2015 to 2018. All cases had been diagnosed with BrCa by a pathologist on the basis of hematoxylin–eosin (HE) staining. Relevant clinicopathological characteristics record for each case were collected by review of patients’ medical files. Ethical approval for the study was obtained from the Clinical Research Ethics Committee, NJMU. Pathologic staging was determined by a pathologist based on AJCC Cancer Staging Manual 8th classification criteria. All the participants voluntarily joined this study with informed contents.
A total of 46 BrCa sections were deparaffinised at 55 °C for 30 min. The sections were then washed with xylene for three 5-min. The sections were rehydrated by successive washes in 100, 90 and 70% graded ethanol. Hydrogen peroxidase (0.3%, ZSGB-Bio, Beijing, China) was used to block endogenous peroxidase activity for 20 min. The primary anti-DAAM1 (1:100 dilution, Cat. 14876-1-AP, ProteinTech, Wuhan, China) antibody and DAB and hematoxylin counterstain (ZSGB-Bio) were used to visualize its expression. The percentage of positively stained cells was scored as 0–4: 0 (< 5%), 1 (6–25%), 2 (26–50%), 3 (51–75%) and 4 (> 75%). The staining intensity was scored as 0–3: 0 (negative), 1 (weak), 2 (moderate), and 3 (strong). The immunoreactivity score (IRS) equals to the percentages of positive cells multiplied with staining intensity. Immunostained sections were scanned by a microscope (Olympus Corporation, Tokyo, Japan).
A next-generation sequencing of metastatic BrCa tissues (data not published) revealed some SNPs, including rs79036859 and rs45476291, locating in the 3′-UTR of DAAM1. After a review of dbSNP database (https://www.ncbi.nlm.nih.gov/snp) and PolymiRTS Database 3.0 (http://compbio.uthsc.edu/miRSNP), we selected the candidate SNP (rs79036859) suggested as a transcriptional regulation factor for the 3′-UTR of DAAM1. SNP genotyping was conducted by allelic discrimination using the TaqMan SNP Genotyping Assays according to the manufacturer’s instructions (Applied Biosystems). Specific primers (TATCTCCTGAAAGAGATAAGA, GTTTTTCCAACAACTCCAGT) and FAM/VIC-labeled TaqMan probes (FAM-labeled CAAACAAACAAAAAAAGCTTGCAAAATATTTT, VIC-labeled CAAACAAACAAAAAAGGCTTGCAAAATATTTT) were designed and supplied by Synbio Technologies (Soochow, China). The PCR conditions were as follows: initiation at 98 °C for 10 min, followed by 40 cycles of denaturation at 95 °C for 30 s and annealing/extension at 60 °C for 60 s. PCR application was undergoing in a StepOnePlus Real-Time PCR System (Applied Biosystems).
MCF-10A, MDA-MB-231, MCF-7, and COS-7 cell lines were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China). MCF-7, MDA-MB-231, and COS-7 cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM, high glucose) (Hyclone, Thermo Scientific, Waltham, MA) supplemented with 10% (v/v) fetal bovine serum (FBS) (Hyclone) at 37 °C with 5% CO2. MCF-10A cells were cultured in DMEM/F12 media supplemented with 5% (v/v) horse serum, 20 ng/mL human EGF, 10 μg/mL insulin, 0.5 μg/mL hydrocortisone, penicillin, streptomycin and 100 ng/mL cholera toxin (Sigma-Aldrich, St. Louis, MO).
For subsequent assays, cells were transfected with miR-208a-5p mimic, miR-208a-5p inhibitor (an anti-sense of miR-208a-5p), or miRNA mimic control, which is synthesized in RiboBio Co., Ltd. (Guangzhou, China), using Lipofectamine 2000 Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions.
Cells were placed in 35-mm dishes (6 × 105 cells/dish) and transfected with synthesized miR-208a-5p mimic, miR-208a-5p inhibitor (anti-sense of miR-208a-5p), or miRNA mimic control. 72 h after transfection, all cells were harvested the proteins with lysis buffer. SDS–polyacrylamide gel electrophoresis and Western blotting analysis were performed as standard protocols. The primary antibodies for DAAM1 (1:1000 dilution, Cat. 14876-1-AP, ProteinTech), RhoA (1:1000 dilution, Cat. 10749-1-AP, ProteinTec), β-actin (1:5000 dilution, Cat. 60008-1-Ig, ProteinTec) were used. DAAM1 protein levels were normalized to β-actin for each sample.
To detect the active level of DAAM1, we employed GST-RhoA beads as bait. The activate level of DAAM1 was detected by the Pulldown assays and subsequently immunoblotted with anti-DAAM1 antibody (Cat. 14876-1-AP, ProteinTech) [6]. SDS-PAGE and Western blotting were performed using the above methods.
The 3′-UTR of DAAM1 which contained the putative target site of miR-208a-5p was synthesized by Integrated Biotech Solutions Co., Ltd (Shanghai, China) and ligated into pGL3 construct (Promega, Madison, WI). The constructs pGL3-DAAM1-3′-UTR-WT or pGL3-DAAM1-3′-UTR-mutant (200 ng) and pRL-TK (80 ng, Promega) were co-transfected with 60 pmol miR-208a-5p mimic or miRNA mimic control by Lipofectamine 2000 (Invitrogen). Twenty-four hours after transfection, Dual-Luciferase Reporter Assay System (Promega) was performed to measure luciferase activity.
Migratory ability of cancer cells was tested in a modified Boyden chamber (Cat. 3422, Costar, Corning, NY). The detail protocol was described as previously [6].
Cells were placed on glass cover-slides and subjected to actin cytoskeleton staining. The detail protocol was described as previously [17]. The images were captured by a laser scanning confocal microscope (Zeiss LSM710, Oberkochen, Germany).
MiRNA of BrCa cells and tissues were extracted by using mirVana™ miRNA isolation kit (Ambion, Austin, TX). The primers for miRNA reverse transcription were synthesized in RiboBio Co., Ltd. (Guangzhou, China) called Bulge-Loop™ miRNA qRT-PCR Primer Set as previously described [17]. Primers used for DAAM1 amplification were GAPDH: 5′-TGAACGGGAAGCTCACTGG-3′ (sense) and 5′-TCCACCACCCTGTTGCTGTA-3′ (antisense); DAAM1: 5′-AAATTGAAACGGAATCGCAAAC-3′ (sense) and 5′-GCAAGGCAGTGTAATGAAACG-3′ (antisense). SYBR Green (SYBR® Premix Ex Taq™ II, TaKaRa, Dalian, China) was used to label the amplified genes. The 2−ΔΔCt method was used for miR-208a-5p or DAAM1 expression analysis.
Total protein lysates extracted from BrCa cells were turned to measure RhoA activity by using RhoA GTPase activation assays (Cat. BK121, Cytoskeleton Inc., Denver, CO). RhoA activation was described as previously [6].
DAAM1 (Affy ID: 216060_s_at) mRNA expression data and survival information (progression free survival, overall survival, post progression survival and distant metastasis free survival) were collected from Kaplan–Meier plotter (http://kmplot.com). Then, the prognostic significance of DAAM1 mRNA was analyzed in BrCa. Kaplan–Meier survival plots were generated with survival curves compared by log-rank test.
All statistical analyses were calculated using SPSS 25.0 software (Chicago, IL). Most of the data were analyzed by Student’s t-test or one-way ANOVA followed by Dunnett’s multiple posthoc tests. All data are presented as means ± SDs of five independent experiments if not noted. The associations between DAAM1 mRNA expression levels, genotypes distribution of DAAM1 SNP, along with miR-208a-5p expression status and clinicopathological characteristics were performed using Pearson’s Chi squared test. The correlations between DAAM1 mRNA expression and miR-208a-5p expression or between DAAM1 mRNA level and protein level were assessed by Spearman’s correlation analysis.










